brzeg lekarze

Wraz z IL-12 i IL-15, indukowane i podtrzymywane przez IL-18 reakcje komórkowe Th1, manifestują się jako IFN-y. produkcja. Ponadto IL-18 niezależnie promował wytwarzanie monokiny, przez bezpośredni wpływ na makrofagi maziówkowe. Metody Odczynniki. DMEM, RPMI 1640, glutaminę, penicylinę / streptomycynę, FCS, LPS i trypsynę / EDTA uzyskano z Sigma (Poole, Zjednoczone Królestwo), a kolagenazę otrzymano z Worthington Scientific (Lakewood, New Jersey, USA). Rekombinowany ludzki TNF-a i IFN-y były prezenty od GR Adolfa (Bender Wien, Wiedeń, Austria). Rekombinowane ludzkie IL-la, IL-10, IL-12, TGF-a i mysia IL-18 pochodziły z R & D Systems (Abingdon, Wielka Brytania). Klonowanie, ekspresja, oczyszczanie i aktywność biologiczna ludzkiej IL-18. Całkowity RNA wyekstrahowano z komórek THP-1 (stymulowano przez 18 godzin ludzkim IFN-a [100 U / ml] i LPS [1 .g / ml]) stosując odczynnik TRIzol (Life Technologies, Paisley, Zjednoczone Królestwo). RNA zostało transkrybowane do cDNA przy użyciu SuperScript II RT (Life Technologies) zgodnie ze standardowym protokołem. Zestaw par czynników projektowanych z danych dotyczących sekwencji ludzkiej IL-18 zastosowano do klonowania hIL-18 z cDNA: sens 5. ATCAGGATCCTTTGGCAAGCTTGAATCTAAATTATC3. antysensowny 5. ATAGGTCGACTTCGTTTTGAACAGTGAACATTATAG3. (produkt 487 pz). Produkt PCR potwierdzono przez sekwencjonowanie, klonowano do wektora ekspresyjnego pQE-30 (QIAGEN, Dorking, Wielka Brytania) i wyrażono w Escherichia coli M15 (QIAGEN). Po indukcji izopropylo-D-tiogalaktozydem (BioLine, Londyn, Wielka Brytania), IL-18 ekstrahowano w warunkach natywnych i oczyszczono jako białko fuzyjne znakowane 6x histydyną przy użyciu niklowego agarozowego systemu oczyszczania (QIAGEN) według producenta. s zalecenia. Czystość analizowano za pomocą SDS-PAGE i barwienia błękitem Coomassie, które wykazywały prążek pojedynczego białka w przybliżeniu 23 000. Aktywność biologiczną określono za pomocą IFN-y indukcja z hodowli PBMC (12). Cytokiny stosowane w testach in vitro były wolne od LPS, jak oceniono za pomocą testu limo amoebocytów (Sigma). Generowanie przeciwciał anty-IL-18. Monoklonalne przeciwciała przeciwko ludzkiej IL-18 wytworzono w sposób opisany uprzednio (22). Pokrótce, po immunizacji i wzmocnieniu myszy BALB / c rekombinowaną IL-18, komórki śledziony usunięto do fuzji z komórkami NS0. Pozytywne klony zostały wybrane i sprawdzone pod względem swoistości za pomocą testu ELISA. Klon D3B6 (IgG1) został wybrany do rutynowego stosowania. Poliklonalna owcza antyludzka IL-18 została podniesiona standardowymi metodami (SAPU, Carluke, Wielka Brytania). Potwierdzające przeciwciała monoklonalne przeciw ludzkiej IL-18 (klony 1.51E3E1, 3.51D3D4 i 6.42D4D1) były prezentem od A. Jackson (Imperial Cancer Research Fund, Leeds, Wielka Brytania). Specyficzność przeciwciała potwierdzono metodą Western blotting. Materiał oczyszczony przez powinowactwo poddany elektroforezie w 15% SDS-PAGE przeniesiono na nitrocelulozę (Sigma). Po zablokowaniu przez noc błonę inkubowano z D3B6, a następnie owczą przeciwmysią IgG-HRP (Amersham Life Sciences, Little Chalfont, Wielka Brytania) i opracowano przez wzmocnioną chemiluminescencję (Amersham International, Wielka Brytania). D3B6 związany IL-18 o masie cząsteczkowej 23000, ale nie IL-1 p (dane nie pokazane). Materiały kliniczne i przygotowanie komórek. Błony maziowe (próbki z artroplastyki), płyny i próbki krwi uzyskano od pacjentów z RZS i pacjentów z OA spełniających kryteria American College of Rheumatology (23). Zawiesiny pojedynczych komórek przygotowano z membran jak opisano wcześniej (24). Pokrótce, fragmenty tkanki strawiono kolagenazą (2,5 mg / ml) w 37 ° C przez 2 godziny, przesączono przez gazę i przemyto. W razie potrzeby fibroblasty maziówkowe (SFB) hodowano z pierwotnych zawiesin komórkowych w 25-cm kolbach i stosowano od trzeciego do piątego pasażowania (> 99% AS02 + za pomocą cytometrii przepływowej; Binding Site, Birmingham, Wielka Brytania)
[podobne: badania prenatalne żory, badania prenatalne żory szyjna, klinika arciszewscy ]