terapia współuzależnienia wrocław

Frakcje komórek jednojądrzastych krwi i mazi stawowej (SF) otrzymano przez wirowanie w gradiencie gęstości przez Lymphoprep (Nycomed, Oslo, Norwegia). Hodowlę prowadzono w 37 ° C / 5% CO2 stosując tworzywa Nunclon do hodowli tkankowej (Life Technologies) w RPMI-1640 uzupełnionym 10% FCS, 2 mM glutaminy, 100 IU / ml penicyliny, 100 mg / ml streptomycyny i 1,25 g / mL amfoterycyny B. Komórki w x 106 / ml hodowano przez 48 godzin, o ile nie podano inaczej. Supernatanty przechowywano w temperaturze około 70 ° C. Komórki jednojądrzaste SF dla wewnątrzkomórkowego TNF-a ekspresję hodowano przez 4 godziny z 10 .g / ml Brefeldiny A (Sigma). Ocena cytokin i receptorów cytokin. IL-18 mierzono za pomocą ELISA, stosując przeciwciała z R & D Systems lub stosując mAb D3B6 w połączeniu z owczą przeciw ludzką IL-18 hodowaną w naszych laboratoriach. Pokrótce, płytki do mikromiareczkowania Immulon4 (Dynex, Billingshurst, Wielka Brytania) pokryto mysim monoklonalnym przeciwciałem przeciw ludzkiej IL-18 (R & D Systems lub D3B6). Rekombinowaną IL-18 lub próbki inkubowano i wykrywano za pomocą skoniugowanej z biotyną koziej antyludzkiej IL-18 (R & D Systems) lub skoniugowanej z biotyną owcy antyludzkiej IL-18 i opracowywano z substratem streptawidyna-HRP (SAPU) i TMB ( Dynex). Czynnik reumatoidalny (RF) usunięto z SF przez uprzednią inkubację z kuleczkami RapiTex (Behring Diagnostics, Marburg, Niemcy). Jako dodatkowa kontrola swoistości i w celu zminimalizowania zanieczyszczenia RF, monoklonalne mysie przeciwciało anty-IL-1. (R & D Systems) zastosowano jako nieodpowiednie przeciwciało wychwytujące, a następnie próbkę, przeciwciała drugorzędowe i system detekcji, jak poprzednio. IFN-. zmierzono za pomocą ELISA, jak już tu opisano, stosując sparowany anty-ludzki IFN-y. przeciwciała (podarunek T. Meagera, Narodowy Instytut Standardów Biologicznych i Kontroli, Potters Bar, Wielka Brytania), detekcja za pomocą sprzężonego z peroksydazą chrzanową sprzężonego osła anty-króliczego IgG (Jackson ImmunoResearch Laboratories Inc., West Grove, Pennsylvania, USA), i Podłoże TMB. GM-CSF mierzono za pomocą ELISA (Genzyme, Cambridge, Massachusetts, USA). Wewnątrzkomórkowy TNF-. ekspresję zidentyfikowano w permeabilizowanych populacjach jednojądrzastych maziówki za pomocą analizy FACS (Becton Dickinson, Cowley, Wielka Brytania) przy użyciu skoniugowanego z PE monoklonalnego anty-TNF-a. przeciwciało (R & D Systems), razem z FITC anty-CD3 lub przeciwciałami anty-CD14 FITC (Becton Dickinson). Ekspresja receptora IL-18 została określona za pomocą analizy FACS przy użyciu monoklonalnego przeciwciała przeciwko ludzkiemu receptorowi IL-18 (R & D Systems). Ekspresja mRNA dla IL-18 i IL-18R w tkance maziówkowej. cDNA przygotowano z tkanki maziowej i fibroblastów przy użyciu ekstrakcji TRIzol (Life Technologies) i RT. MRNA IL-18 wykryto przy użyciu starterów opisanych poprzednio do klonowania IL-18. Startery dla IL-18R były następujące: sens 5. CCCAACGATAAAGAAGAACGC C3. antysensowny 5. TGTCTGTGCCTCCCGTGCTGGC3. (produkt 419 pz) i p-aktyna: sens 5 (GTGGGGCGCCCCAGGCACCA3. antysensowny 5. CTCCTTAATGTCAC GCACG ATTTC3. (produkt 548 bp). Oszacowanie tlenku azotu. Tlenek azotu (NO) mierzono jako utleniony produkt, azotyn, stosując reakcję Griessa (24). Immunohistochemia. Skrawki parafiny utrwalone formalnie (3 .m) barwiono standardowym protokołem streptawidyna-HRP. Produkt oglądano z tetrachlorkiem 3,3-dia-minobenzydyny (DAB, Sigma) i barwiono kontrastowo hematoksyliną (Sigma). Ekspresję IL-18 oceniano ilościowo przez 2 niezależnych obserwatorów za pomocą mikroskopii świetlnej. Barwienie oznaczono ilościowo od 0 do 4 w następujący sposób. Warstwy wyściełające (LL) / śródmiąższowe (IS): 0, bez przebarwień; 1, <5% dodatnich komórek / jąder w polu o dużej mocy (HPF; × 400); 2, 5-30%; 3, 30 -90%; 4,> 90%. Obszar agregatów limfatycznych (LA): 0, bez barwienia; 1, <5%; 2, 5-20%; 3, 20 -40%; 4,> 40%. Pozytywne naczynia wyrażono jako procent wszystkich naczyń na HPF
[podobne: przychodnia gdynia karwiny, szypryt chojnice, krioglobulinemia ]